Cart 22 Product Products 2 805,68 € (empty)
-
1 x C13orf3-ch...121,50 € -
1 x HIST4H4-hi...113,40 € -
1 x POU5F2-POU...121,50 € -
-
1 x COX7C-cyto...113,40 € -
1 x C13orf31-c...121,50 € -
1 x GTPBP8-GTP...113,40 € -
1 x NSMCE4A-no...121,50 € -
-
1 x C19orf25-c...113,40 € -
1 x EIF3K-euka...113,40 € -
1 x CAPNS1-cal...121,50 € -
1 x MARK4-MAP/...113,40 € -
1 x HSD17B11-h...121,50 € -
1 x GORASP1-go...121,50 € -
1 x RMND5A-req...121,50 € -
1 x MIPOL1-mir...113,40 € -
1 x GMDS-GDP-m...121,50 € -
1 x DSTN-destr...113,40 € -
1 x TIMM23-tra...113,40 € -
1 x MMAB-methy...113,40 € -
1 x MTIF3-mito...121,50 €
No products
To be determined Shipping
2 805,68 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 22 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 805,68 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 805,68 €
View larger 
SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene
PTXBC013611
New product
Data sheet of SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013611 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC31A1 |
| Origin species: | Human |
| Product name: | SLC31A1-solute carrier family 31 (copper transporters), member 1 Gene |
| Size: | 2ug |
| Accessions: | BC013611 |
| Gene id: | 1317 |
| Gene description: | solute carrier family 31 (copper transporters), member 1 |
| Synonyms: | COPT1; CTR1; high affinity copper uptake protein 1; copper transport 1 homolog; copper transporter 1; solute carrier family 31 (copper transporter), member 1; solute carrier family 31 (copper transporters), member 1; solute carrier family 31 member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggatcattcccaccatatggggatgagctatatggactccaacagtaccatgcaaccttctcaccatcacccaaccacttcagcctcacactcccatggtggaggagacagcagcatgatgatgatgcctatgaccttctactttggctttaagaatgtggaactactgttttccggtttggtgatcaatacagctggagaaatggctggagcttttgtggcagtgtttttactagcaatgttctatgaaggactcaagatagcccgagagagcctgctgcgtaagtcacaagtcagcattcgctacaattccatgcctgtcccaggaccaaatggaaccatccttatggagacacacaaaactgttgggcaacagatgctgagctttcctcacctcctgcaaacagtgctgcacatcatccaggtggtcataagctacttcctcatgctcatcttcatgacctacaacgggtacctctgcattgcagtagcagcaggggccggtacaggatacttcctcttcagctggaagaaggcagtggtagtggatatcacagagcattgccattga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - MIS12, MIND kinetochore complex component, homolog (yeast) - proteasome (prosome, macropain) 26S subunit, non-ATPase, 8 - v-ets erythroblastosis virus E26 oncogene homolog 1 (avian) - polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa |