Cart 18 Product Products 2 807,45 € (empty)
-
-
1 x TYR-tyrosi...121,50 € -
1 x STC1-stann...113,40 € -
-
-
1 x BTN2A1-but...121,50 € -
1 x TUBG1-tubu...121,50 € -
1 x PLEKHA8-pl...121,50 € -
1 x ARHGAP17-R...113,40 € -
1 x MTHFD2-met...113,40 € -
1 x Phospho-My...259,07 € -
-
-
1 x ARL2-ADP-r...113,40 € -
1 x AGPAT1-1-a...121,50 € -
1 x KRT19-kera...121,50 € -
1 x TDO2-trypt...121,50 € -
No products
To be determined Shipping
2 807,45 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 18 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 2 807,45 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 2 807,45 €
Data sheet of DHFR-dihydrofolate reductase Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DHFR-dihydrofolate reductase Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000192 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DHFR |
| Origin species: | Human |
| Product name: | DHFR-dihydrofolate reductase Gene |
| Size: | 2ug |
| Accessions: | BC000192 |
| Gene id: | 1719 |
| Gene description: | dihydrofolate reductase |
| Synonyms: | DHFRP1; DYR |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttggttcgctaaactgcatcgtcgctgtgtcccagaacatgggcatcggcaagaacggggacctgccctggccaccgctcaggaatgaattcagatatttccagagaatgaccacaacctcttcagtagaaggtaaacagaatctggtgattatgggtaagaagacctggttctccattcctgagaagaatcgacctttaaagggtagaattaatttagttctcagcagagaactcaaggaacctccacaaggagctcattttctttccagaagtctagatgatgccttaaaacttactgaacaaccagaattagcaaataaagtagacatggtctggatagttggtggcagttctgtttataaggaagccatgaatcacccaggccatcttaaactatttgtgacaaggatcatgcaagactttgaaagtgacacgttttttccagaaattgatttggagaaatataaacttctgccagaatacccaggtgttctctctgatgtccaggaggagaaaggcattaagtacaaatttgaagtatatgagaagaatgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heme binding protein 2 - homeobox containing 1 - Z-DNA binding protein 1 - zinc finger protein 24 |