Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RABL4-RAB, member of RAS oncogene family-like 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RABL4-RAB, member of RAS oncogene family-like 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000566 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RABL4 |
| Origin species: | Human |
| Product name: | RABL4-RAB, member of RAS oncogene family-like 4 Gene |
| Size: | 2ug |
| Accessions: | BC000566 |
| Gene id: | 11020 |
| Gene description: | RAB, member of RAS oncogene family-like 4 |
| Synonyms: | RABL4; BBS19; RAYL; intraflagellar transport protein 27 homolog; RAB, member of RAS oncogene family-like 4; rab-like protein 4; intraflagellar transport 27 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgaagctggcagccaaatgcatcctggcaggagacccagcagtgggcaagaccgccctggcacagatcttccgcagtgatggagcccatttccagaaaagctacaccctgacaacaggaatggatttggtggtgaagacagtgccagttcctgacacgggagacagtgtggaactcttcatttttgactctgctggcaaggagctgttttcggaaatgctggataaattgtgggagagtcccaatgtcttatgtctcgtctatgatgtgaccaatgaagaatccttcaacaactgcagcaagtggctggagaaggctcggtcacaggctccaggcatctctctcccaggtgttttagttgggaacaagacagacctggccggcagacgagcagtggactcagctgaggcccgggcatgggcgctgggccagggcctggaatgttttgaaacatccgtgaaagagatggaaaacttcgaagcccctttccactgccttgccaagcagttccaccagctgtaccgggagaaggtggaggttttccgggccctggcatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 - eukaryotic translation initiation factor 6 - FGGY carbohydrate kinase domain containing - serine peptidase inhibitor, Kazal type 1 |