PTXBC000566
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC000566 |
Product type: | DNA & cDNA |
Ncbi symbol: | RABL4 |
Origin species: | Human |
Product name: | RABL4-RAB, member of RAS oncogene family-like 4 Gene |
Size: | 2ug |
Accessions: | BC000566 |
Gene id: | 11020 |
Gene description: | RAB, member of RAS oncogene family-like 4 |
Synonyms: | RABL4; BBS19; RAYL; intraflagellar transport protein 27 homolog; RAB, member of RAS oncogene family-like 4; rab-like protein 4; intraflagellar transport 27 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggtgaagctggcagccaaatgcatcctggcaggagacccagcagtgggcaagaccgccctggcacagatcttccgcagtgatggagcccatttccagaaaagctacaccctgacaacaggaatggatttggtggtgaagacagtgccagttcctgacacgggagacagtgtggaactcttcatttttgactctgctggcaaggagctgttttcggaaatgctggataaattgtgggagagtcccaatgtcttatgtctcgtctatgatgtgaccaatgaagaatccttcaacaactgcagcaagtggctggagaaggctcggtcacaggctccaggcatctctctcccaggtgttttagttgggaacaagacagacctggccggcagacgagcagtggactcagctgaggcccgggcatgggcgctgggccagggcctggaatgttttgaaacatccgtgaaagagatggaaaacttcgaagcccctttccactgccttgccaagcagttccaccagctgtaccgggagaaggtggaggttttccgggccctggcatga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 - eukaryotic translation initiation factor 6 - FGGY carbohydrate kinase domain containing - serine peptidase inhibitor, Kazal type 1 |