Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GLO1-glyoxalase I Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GLO1-glyoxalase I Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001741 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GLO1 |
| Origin species: | Human |
| Product name: | GLO1-glyoxalase I Gene |
| Size: | 2ug |
| Accessions: | BC001741 |
| Gene id: | 2739 |
| Gene description: | glyoxalase I |
| Synonyms: | GLOD1; GLYI; HEL-S-74; lactoylglutathione lyase; S-D-lactoylglutathione methylglyoxal lyase; aldoketomutase; epididymis secretory protein Li 74; glx I; glyoxalase domain containing 1; ketone-aldehyde mutase; lactoyl glutathione lyase; methylglyoxalase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaaccgcagcccccgtccggcggcctcacggacgaggccgccctcagttgctgctccgacgcggaccccagtaccaaggattttctattgcagcagaccatgctacgagtgaaggatcctaagaagtcactggatttttatactagagttcttggaatgacgctaatccaaaaatgtgattttcccattatgaagttttcactctacttcttggcttatgaggataaaaatgacatccctaaagaaaaagatgaaaaaatagcctgggcgctctccagaaaagctacacttgagctgacacacaattggggcactgaagatgatgagacccagagttaccacaatggcaattcagaccctcgaggattcggtcatattggaattgctgttcctgatgtatacagtgcttgtaaaaggtttgaagaactgggagtcaaatttgtgaagaaacctgatgatggtaaaatgaaaggcctggcatttattcaagatcctgatggctactggattgaaattttgaatcctaacaaaatggcaaccttaatgtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vasohibin 1 - homeobox B6 - KIAA1257 - KIAA0513 |