Cart 1 Product Products 112,04 € (empty)
No products
To be determined Shipping
112,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 112,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 112,04 €
View larger 
Data sheet of KCNK4-potassium channel, subfamily K, member 4 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about KCNK4-potassium channel, subfamily K, member 4 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033577 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | KCNK4 |
| Origin species: | Human |
| Product name: | KCNK4-potassium channel, subfamily K, member 4 Gene |
| Size: | 2ug |
| Accessions: | BC033577 |
| Gene id: | 50801 |
| Gene description: | potassium channel, subfamily K, member 4 |
| Synonyms: | K2p4.1; TRAAK1; potassium channel subfamily K member 4; K2P4.1 potassium channel; TWIK-related arachidonic acid-stimulated potassium channel protein; potassium channel, subfamily K, member 4; potassium channel, two pore domain subfamily K, member 4; two pore K(+) channel KT4.1; two pore K+ channel KT4.1; two pore potassium channel KT4.1; potassium two pore domain channel subfamily K member 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgacgacagctccccaggagccccccgcccggcccctccaggcgggcagtggagctggcccggcgcctgggcgcgccatgcgcagcaccacgctcctggccctgctggcgctggtcttgctttacttggtgtctggtgccctggtgttccgggccctggagcagccccacgagcagcaggcccagagggagctgggggaggtccgagagaagttcctgagggcccatccgtgtgtgagcgaccaggagctgggcctcctcatcaaggaggtggctgatgccctgggagggggtgcggacccagaaaccaactcgaccagcaacagcagccactcagcctgggacctgggcagcgccttctttttctcagggaccatcatcaccaccatcggctatggcaatgtggccctgcgcacagatgccgggcgcctcttctgcatcttttatgcgctggtggggattccgctgtttgggatcctactggcaggggtcggggaccggctgggctcctccctgcgccatggcatcggtcacattgaagccatcttcttgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - C-type lectin domain family 4, member E - isopentenyl-diphosphate delta isomerase 1 - zinc finger, FYVE domain containing 21 - lectin, galactoside-binding, soluble, 3 |