Cart 5 Product Products 699,53 € (empty)
-
-
-
1 x CMC1-COX...113,40 € -
1 x FXR2...259,07 € -
1 x FSD1-fibro...121,50 €
No products
To be determined Shipping
699,53 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 699,53 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 699,53 €
Data sheet of TMEM9-transmembrane protein 9 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMEM9-transmembrane protein 9 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001106 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMEM9 |
| Origin species: | Human |
| Product name: | TMEM9-transmembrane protein 9 Gene |
| Size: | 2ug |
| Accessions: | BC001106 |
| Gene id: | 252839 |
| Gene description: | transmembrane protein 9 |
| Synonyms: | DERM4; TMEM9A; transmembrane protein 9; dermal papilla-derived protein 4 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagctcttatctttggtggctgtggtcgggtgtttgctggtgcccccagctgaagccaacaagagttctgaagatatccggtgcaaatgcatctgtccaccttatagaaacatcagtgggcacatttacaaccagaatgtatcccagaaggactgcaactgcctgcacgtggtggagcccatgccagtgcctggccatgacgtggaggcctactgcctgctgtgcgagtgcaggtacgaggagcgcagcaccaccaccatcaaggtcatcattgtcatctacctgtccgtggtgggtgccctgttgctctacatggccttcctgatgctggtggaccctctgatccgaaagccggatgcatacactgagcaactgcacaatgaggaggagaatgaggatgctcgctctatggcagcagctgctgcatccctcgggggaccccgagcaaacacagtcctggagcgtgtggaaggtgcccagcagcggtggaagctgcaggtgcaggagcagcggaagacagtcttcgatcggcacaagatgctcagctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L13a - cysteine-rich protein 2 - MLX interacting protein - insulin induced gene 2 |