Cart 43 Product Products 6 061,20 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 € -
1 x PLA2G2D-ph...113,40 € -
1 x C20orf177-...121,50 € -
1 x WDR53-WD...121,50 € -
1 x CCL22-chem...113,40 € -
1 x PRRG4-prol...113,40 € -
1 x MGC87631-s...113,40 € -
-
-
1 x POLB-polym...121,50 € -
1 x ANXA8-anne...121,50 € -
-
-
1 x ATPAF2-ATP...121,50 € -
1 x HTR2B-5-hy...121,50 € -
1 x GSTK1-glut...113,40 € -
-
1 x TMEM55A-tr...113,40 € -
1 x ORAI1-ORAI...113,40 € -
-
1 x ASB7-ankyr...121,50 € -
-
1 x WFDC9-WAP...113,40 € -
-
-
-
1 x CCNL1-cycl...113,40 € -
1 x UBE2T-ubiq...113,40 € -
-
-
1 x ATG4D-ATG4...121,50 € -
1 x C20orf30-c...113,40 € -
1 x NTN4-netri...121,50 €
No products
To be determined Shipping
6 061,20 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 43 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 6 061,20 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 6 061,20 €
View larger 
FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
PTXBC001107
New product
Data sheet of FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001107 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FUSIP1 |
| Origin species: | Human |
| Product name: | FUSIP1-FUS interacting protein (serine/arginine-rich) 1 Gene |
| Size: | 2ug |
| Accessions: | BC001107 |
| Gene id: | 10772 |
| Gene description: | FUS interacting protein (serine/arginine-rich) 1 |
| Synonyms: | FUSIP1; FUSIP2; NSSR; PPP1R149; SFRS13; SFRS13A; SRp38; SRrp40; TASR; TASR1; TASR2; serine/arginine-rich splicing factor 10; 40 kDa SR-repressor protein; FUS interacting protein (serine-arginine rich) 1; FUS-interacting protein (serine-arginine rich) 2; SR splicing factor 10; TLS-associated SR protein; TLS-associated protein TASR; TLS-associated protein with SR repeats; TLS-associated protein with Ser-Arg repeats; TLS-associated serine-arginine protein 1; TLS-associated serine-arginine protein 2; neural-salient SR protein; protein phosphatase 1, regulatory subunit 149; serine-arginine repressor protein (40 kDa); splicing factor SRp38; splicing factor, arginine/serine-rich 13; splicing factor, arginine/serine-rich 13A; serine and arginine rich splicing factor 10 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtcccgctacctgcgtccccccaacacgtctctgttcgtcaggaacgtggccgacgacaccaggtctgaagacttgcggcgtgaatttggtcgttatggtcctatagttgatgtgtatgttccacttgatttctacactcgccgtccaagaggatttgcttatgttcaatttgaggatgttcgtgatgctgaagacgctttacataatttggacagaaagtggatttgtggacggcagattgaaatacagtttgcccagggggatcgaaagacaccaaatcagatgaaagccaaggaagggaggaatgtgtacagttcttcacgctatgatgattatgacagatacagacgttctagaagccgaagttatgaaaggaggagatcaagaagtcggtcttttgattacaactatagaagatcgtatagtcctagaaacagtagaccgactggaagaccacggcgtagcagaagccattccgacaatgatagaccaaactgcagctggaatacccagtacagttctgcttactacacttcaagaaagatctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cyclin-dependent kinase inhibitor 1B (p27, Kip1) - heterogeneous nuclear ribonucleoprotein A2/B1 - C1q and tumor necrosis factor related protein 1 - chromobox homolog 4 (Pc class homolog, Drosophila) |