CBFB-core-binding factor, beta subunit Gene View larger

CBFB-core-binding factor, beta subunit Gene

PTXBC018509

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of CBFB-core-binding factor, beta subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CBFB-core-binding factor, beta subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018509
Product type: DNA & cDNA
Ncbi symbol: CBFB
Origin species: Human
Product name: CBFB-core-binding factor, beta subunit Gene
Size: 2ug
Accessions: BC018509
Gene id: 865
Gene description: core-binding factor, beta subunit
Synonyms: PEBP2B; core-binding factor subunit beta; CBF-beta; PEA2-beta; PEBP2-beta; SL3-3 enhancer factor 1 beta subunit; SL3-3 enhancer factor 1 subunit beta; SL3/AKV core-binding factor beta subunit; polyomavirus enhancer binding protein 2, beta subunit; core-binding factor beta subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaagctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgccaggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccacaggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaacacctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctcccatgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggatggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatgcattagcacaacaggcctttgaagaggctcggagaaggacacgcgaatttgaagatagagacaggtctcatcgggaggaaatggaggtgagagtttcacagctgctggcagtaactggcaagaagacaacaagaccctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - SEC11 homolog C (S. cerevisiae)
- ras homolog gene family, member A
- dual specificity phosphatase 14
- delta-like 2 homolog (Drosophila)

Reviews

Buy CBFB-core-binding factor, beta subunit Gene now

Add to cart