GPBP1-GC-rich promoter binding protein 1 Gene View larger

GPBP1-GC-rich promoter binding protein 1 Gene

PTXBC000267

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of GPBP1-GC-rich promoter binding protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about GPBP1-GC-rich promoter binding protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000267
Product type: DNA & cDNA
Ncbi symbol: GPBP1
Origin species: Human
Product name: GPBP1-GC-rich promoter binding protein 1 Gene
Size: 2ug
Accessions: BC000267
Gene id: 65056
Gene description: GC-rich promoter binding protein 1
Synonyms: GPBP; SSH6; VASCULIN; vascular wall-linked protein; GC-rich promoter binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcgcactgataagaagagtgaatttttgaaagcattgaaaagagacagagtagaagaggaacatgaagatgaaagccgtgctggctcagagaaggatgacgactcatttaatttacataacagcaatagtactcaccaagaaagggatataaaccgaaacttcgatgaaaatgaaattcctcaagagaatggcaatgcctcagtgatttcccagcagatcattcggtcttcaaccttcccacaaactgatgttctttcaagttcacttgaggcagaacacagattgttaaaggaaatgggctggcaggaagacagtgaaaatgatgaaacatgtgctcccttaactgaggatgaaatgagagaattccaagttattagtgaacagttacagaagaatggtctgagaaaaaatggtattttgaaaaatggcttgatctgtgacttcaagtttggaccgtggaagaacagcactttcaaacccacaactgagaatgatgacacagagacaagtagcagtgatacatcagatgacgacgatgtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - methyl-CpG binding domain protein 5
- phosphoglycerate mutase 2 (muscle)
- gap junction protein, beta 6, 30kDa
- tetratricopeptide repeat domain 26

Reviews

Buy GPBP1-GC-rich promoter binding protein 1 Gene now

Add to cart