PDAP1-PDGFA associated protein 1 Gene View larger

PDAP1-PDGFA associated protein 1 Gene

PTXBC000684

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PDAP1-PDGFA associated protein 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about PDAP1-PDGFA associated protein 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000684
Product type: DNA & cDNA
Ncbi symbol: PDAP1
Origin species: Human
Product name: PDAP1-PDGFA associated protein 1 Gene
Size: 2ug
Accessions: BC000684
Gene id: 11333
Gene description: PDGFA associated protein 1
Synonyms: HASPP28; PAP; PAP1; 28 kDa heat- and acid-stable phosphoprotein; PDGF-associated protein; PDGFA associated protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcctaaaggaggaagaaagggaggccacaaaggccgggcgaggcagtatacaagccctgaggagatcgacgcgcagctgcaggctgagaagcagaaggccagggaagaagaggagcaaaaagaaggtggagatggggctgcaggtgaccccaaaaaggagaagaaatctctagactcagatgagagtgaggatgaagaagatgactaccagcaaaagcgcaaaggcgttgaagggctcatcgacatcgagaaccccaaccgggtggcacagacaaccaaaaaggtcacacaactggatctggacgggccaaaggagctttcgaggagagaacgagaagagattgagaagcagaaggcaaaagagcgttacatgaaaatgcacttggccgggaagacagagcaagccaaggctgacctggcccggctggccatcatccggaaacagcgggaggaggctgcccggaagaaggaagaggaaaggaaagcaaaagacgatgccacattgtcaggaaaacgaatgcagtcactctccctgaataagtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - FUN14 domain containing 2
- apoptosis enhancing nuclease
- YEATS domain containing 4
- stromal antigen 3-like 1

Reviews

Buy PDAP1-PDGFA associated protein 1 Gene now

Add to cart