PTXBC008191
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC008191 |
Product type: | DNA & cDNA |
Ncbi symbol: | CYTH3 |
Origin species: | Human |
Product name: | CYTH3-cytohesin 3 Gene |
Size: | 2ug |
Accessions: | BC008191 |
Gene id: | 9265 |
Gene description: | cytohesin 3 |
Synonyms: | ARNO3; GRP1; PSCD3; cytohesin-3; ARF nucleotide-binding site opener 3; PH, SEC7 and coiled-coil domain-containing protein 3; general receptor of phosphoinositides 1; pleckstrin homology, Sec7 and coiled-coil domains 3; cytohesin 3 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaaccgcggcatcaacgagggcggggacctccctgaggagctgctgaggaatttgtatgagagcattaagaacgagccatttaagatcccggaggacgacgggaacgacctgacccacaccttcttcaaccccgaccgcgagggctggctcctgaagctgggagggcgtgtgaagacctggaagcgccggtggttcatcctgaccgataactgcctctattactttgaatacacaacagataaggagcccaggggaatcatcccgttggaaaacctcagcatcagggaggtggaggacccccggaaacccaactgttttgagctctacaatcccagccacaaagggcaggtcatcaaggcctgtaagacggaggccgacggccgcgtggtagaggggaaccatgtggtgtaccggatctcagccccgagcccggaggagaaggaggagtggatgaaatccatcaaagccagtatcagcagagatcccttctatgacatgttggcaacgaggaaacgaaggattgccaataaaaaatag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - glyoxalase I - vasohibin 1 - homeobox B6 - KIAA1257 |