Cart 15 Product Products 1 993,56 € (empty)
-
1 x C3orf37-ch...121,50 € -
1 x CRYBA4-cry...113,40 € -
1 x TMEM184A-t...121,50 € -
1 x RWDD2A-RWD...121,50 € -
1 x UBA6-ubiqu...121,50 € -
1 x KIAA1305-K...113,40 € -
-
1 x HMGB4-high...113,40 € -
1 x TMEM44-tra...113,40 € -
1 x TNFRSF14-t...121,50 € -
1 x TFB2M-tran...121,50 € -
1 x PSMC6-prot...121,50 € -
1 x TUBB6-tubu...121,50 € -
1 x RAD51L1-RA...121,50 € -
1 x MICA-MHC...121,50 €
No products
To be determined Shipping
1 993,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 15 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 993,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 993,56 €
Data sheet of CAV1-caveolin 1, caveolae protein, 22kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CAV1-caveolin 1, caveolae protein, 22kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009685 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CAV1 |
| Origin species: | Human |
| Product name: | CAV1-caveolin 1, caveolae protein, 22kDa Gene |
| Size: | 2ug |
| Accessions: | BC009685 |
| Gene id: | 857 |
| Gene description: | caveolin 1, caveolae protein, 22kDa |
| Synonyms: | BSCL3; CGL3; LCCNS; MSTP085; PPH3; VIP21; caveolin 1, caveolae protein, 22kDa; cell growth-inhibiting protein 32; caveolin 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgggggcaaatacgtagactcggagggacatctctacaccgttcccatccgggaacagggcaacatctacaagcccaacaacaaggccatggcagacgagctgagcgagaagcaagtgtacgacgcgcacaccaaggagatcgacctggtcaaccgcgaccctaaacacctcaacgatgacgtggtcaagattgactttgaagatgtgattgcagaaccagaagggacacacagttttgacggcatttggaaggccagcttcaccaccttcactgtgacgaaatactggttttaccgcttgctgtctgccctctttggcatcccgatggcactcatctggggcatttacttcgccattctctctttcctgcacatctgggcagttgtaccatgcattaagagcttcctgattgagattcagtgcatcagccgtgtctattccatctacgtccacaccgtctgtgacccactctttgaagctgttgggaaaatattcagcaatgtccgcatcaacttgcagaaagaaatataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - GC-rich promoter binding protein 1 - methyl-CpG binding domain protein 5 - phosphoglycerate mutase 2 (muscle) - gap junction protein, beta 6, 30kDa |