PTXBC001115
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC001115 |
Product type: | DNA & cDNA |
Ncbi symbol: | MPV17 |
Origin species: | Human |
Product name: | MPV17-MpV17 mitochondrial inner membrane protein Gene |
Size: | 2ug |
Accessions: | BC001115 |
Gene id: | 4358 |
Gene description: | MpV17 mitochondrial inner membrane protein |
Synonyms: | MPV17, mitochondrial inner membrane protein; Mpv17, human homolog of glomerulosclerosis and nephrotic syndrome; MpV17 mitochondrial inner membrane protein; protein Mpv17; MTDPS6; SYM1 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atggcactctggcgggcataccagcgggccctggccgctcacccgtggaaagtacaggtcctgacagctgggtccctgatgggcctgggtgacattatctcacagcagctggtggagaggcggggtctgcaggaacaccagagaggccggactctgaccatggtgtccctgggctgtggctttgtgggccctgtggtaggaggctggtacaaggttttggatcggttcatccctggcaccaccaaagtggatgcactgaagaagatgttgttggatcaggggggctttgccccgtgttttctaggctgctttctcccactggtaggggcacttaatggactgtcagcccaggacaactgggccaaactacagcgggattatcctgatgcccttatcaccaactactatctatggcctgctgtgcagttagccaacttctacctggtcccccttcattacaggttggccgttgtccaatgtgttgctgttatctggaactcctacctgtcctggaaggcacatcggctctaa |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - RNA binding protein with multiple splicing - threonine synthase-like 1 (S. cerevisiae) - survival motor neuron domain containing 1 - signal transducing adaptor family member 1 |