TMEM185A-transmembrane protein 185A Gene View larger

TMEM185A-transmembrane protein 185A Gene

PTXBC013793

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMEM185A-transmembrane protein 185A Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMEM185A-transmembrane protein 185A Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC013793
Product type: DNA & cDNA
Ncbi symbol: TMEM185A
Origin species: Human
Product name: TMEM185A-transmembrane protein 185A Gene
Size: 2ug
Accessions: BC013793
Gene id: 84548
Gene description: transmembrane protein 185A
Synonyms: CXorf13; FRAXF; ee3; transmembrane protein 185A; family with sequence similarity 11, member A; fragile site, folic acid type, rare, fra(X)(q28) F
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcctttctgtgcctggtggtcctctactacattgtgtggtccgtcttgttcttgcgctctatggatgtgattgcggagcagcgcaggacacacataaccatggccctgagctggatgaccatcgtcgtgccccttcttacatttgagattctgctggttcacaaactggatggccacaacgccttctcctgcatcccgatctttgtccccctttggctctcgttgatcacgctgatggcaaccacatttggacagaagggaggaaaccactggtggtttggtatccgcaaagatttctgtcagtttctgcttgaaatcttcccatttctacgagaatatggaaacatttcctatgatctccatcacgaagataatgaagaaaccgaagagaccccagttccggagccccctaaaatcgcacccatgtttcgaaagaaggccagggtggtcattacccagagccctgggaagtatgtgctcccacctcccaaattaaatatcgaaatgccagattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Nipped-B homolog (Drosophila)
- chromatin modifying protein 5
- chromatin modifying protein 5
- thiopurine S-methyltransferase

Reviews

Buy TMEM185A-transmembrane protein 185A Gene now

Add to cart