Cart 7 Product Products 807,04 € (empty)
-
1 x ZNF70-zinc...121,50 € -
1 x C14orf79-c...113,40 € -
1 x EGR3-early...121,50 € -
1 x RP11-265F1...121,50 € -
-
1 x TPD52-tumo...113,40 € -
No products
To be determined Shipping
807,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 807,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 807,04 €
View larger 
TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene
PTXBC022030
New product
Data sheet of TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022030 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TSEN15 |
| Origin species: | Human |
| Product name: | TSEN15-tRNA splicing endonuclease 15 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC022030 |
| Gene id: | 116461 |
| Gene description: | tRNA splicing endonuclease 15 homolog (S. cerevisiae) |
| Synonyms: | TSEN15 tRNA splicing endonuclease subunit; C1orf19; PCH2F; sen15; tRNA-splicing endonuclease subunit Sen15; tRNA splicing endonuclease 15 homolog; tRNA-intron endonuclease Sen15; tRNA splicing endonuclease subunit 15 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaggagcgcggcgattccgagccgacccccggctgcagcggcctgggtccgggcggtgttcgcggctttggcgacggcggtggagctccttcgtgggcccctgaggacgcctggatgggcactcaccctaagtatctagaaatgatggaattagatataggagatgccacccaagtttatgtagcgttcttggtttacctggacctcatggaaagcaaaagctggcatgaagtaaactgtgtaggattaccagaactccagctcatctgccttgttggtactgagatagaaggggaggggttacagactgtggtgcctacccccatcactgcttccctcagccataacaggataagggagatcttgaaggcatctcgaaagttgcaaggtgatccagatttgccgatgtcttttactttggccatagtggagtctgattctacaatagtctattataaacttactgatggatttatgctgccagaccctcagaatatttctcttagaagatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - NADH dehydrogenase (ubiquinone) flavoprotein 2, 24kDa - Fc fragment of IgG, low affinity IIa, receptor (CD32) - membrane-bound transcription factor peptidase, site 2 - GATA binding protein 1 (globin transcription factor 1) |