Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of NME3-non-metastatic cells 3, protein expressed in Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about NME3-non-metastatic cells 3, protein expressed in Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000250 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | NME3 |
| Origin species: | Human |
| Product name: | NME3-non-metastatic cells 3, protein expressed in Gene |
| Size: | 2ug |
| Accessions: | BC000250 |
| Gene id: | 4832 |
| Gene description: | non-metastatic cells 3, protein expressed in |
| Synonyms: | DR-nm23; NDPK-C; NDPKC; NM23-H3; NM23H3; c371H6.2; nucleoside diphosphate kinase 3; NDK 3; NDP kinase 3; NDP kinase C; non-metastatic cells 3, protein expressed in; nucleoside diphosphate kinase C; NME/NM23 nucleoside diphosphate kinase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgatctgcctggtgctgaccatcttcgctaacctcttccccgcggcctgcaccggcgcacacgaacgcaccttcctggccgtgaagccggacggcgtgcagcggcggctggtgggcgagattgtgcggcgcttcgagaggaagggcttcaagttggtggcgctgaagctggtgcaggcctccgaggagctgctgcgtgagcactacgccgagctgcgtgaacgcccgttctacggccgccttgtcaagtatatggcctccgggccggtggtggccatggtttggcaggggctggacgtggtgcgcacctcgcgggcgctcatcggagccacgaacccggccgacgccccgcccggcaccatccgcggggatttctgcatcgaggttggcaagaacctgattcacggcagcgactcggtggagagtgcccgccgcgagatcgctctctggttccgcgcagacgagctcctctgctgggaggacagcgctgggcactggctgtatgagtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - insulin-like growth factor 2 (somatomedin A) - ubiquitin-conjugating enzyme E2T (putative) - Sjogren syndrome/scleroderma autoantigen 1 - dual specificity phosphatase 26 (putative) |