Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of RND2-Rho family GTPase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RND2-Rho family GTPase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018096 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RND2 |
| Origin species: | Human |
| Product name: | RND2-Rho family GTPase 2 Gene |
| Size: | 2ug |
| Accessions: | BC018096 |
| Gene id: | 8153 |
| Gene description: | Rho family GTPase 2 |
| Synonyms: | ARHN; RHO7; RhoN; rho-related GTP-binding protein RhoN; CTD-3199J23.4; GTP-binding protein Rho7; ras homolog gene family, member N; rho-related GTP-binding protein Rho7; Rho family GTPase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtgggacacttcaggttcctcttactatgataatgtccggcctctggcctatcctgattctgatgctgtgctcatctgcttcgacattagccgaccagaaacactggacagtgttctcaagaagtggcaaggagagactcaagagttctgccccaatgccaaggttgtgctggttggctgtaaactggacatgcggactgacctggccacactgagggagctgtccaagcagaggcttatccctgttacacatgagcagggcactgtgctggccaagcaggtgggggctgtgtcctatgttgagtgctcctcccggtcctctgagcgcagcgtcagggatgtcttccatgtggctacagtggcctcccttggccgtggccataggcagctgcgccgaactgactcacgccggggaatgcagcgatccgctcagctgtcaggacggccagaccgggggaatgagggcgagatacacaaggatcgagccaaaagctgcaacctcatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - meiosis inhibitor 1 - tubulin, alpha 1b - ATPase type 13A1 - D-amino-acid oxidase |