PTXBC001901
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC001901 |
Product type: | DNA & cDNA |
Ncbi symbol: | BAD |
Origin species: | Human |
Product name: | BAD-BCL2-associated agonist of cell death Gene |
Size: | 2ug |
Accessions: | BC001901 |
Gene id: | 572 |
Gene description: | BCL2-associated agonist of cell death |
Synonyms: | BBC2; BCL2L8; bcl2-associated agonist of cell death; BCL-X/BCL-2 binding protein; BCL2-antagonist of cell death protein; BCL2-binding component 6; BCL2-binding protein; bcl-2-binding component 6; bcl-2-like protein 8; bcl-XL/Bcl-2-associated death promoter; bcl2 antagonist of cell death; bcl2-L-8; BCL2 associated agonist of cell death |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgttccagatcccagagtttgagccgagtgagcaggaagactccagctctgcagagaggggcctgggccccagccccgcaggggacgggccctcaggctccggcaagcatcatcgccaggccccaggcctcctgtgggacgccagtcaccagcaggagcagccaaccagcagcagccatcatggaggcgctggggctgtggagatccggagtcgccacagctcctaccccgcggggacggaggacgacgaagggatgggggaggagcccagcccctttcggggccgctcgcgctcggcgccccccaacctctgggcagcacagcgctatggccgcgagctccggaggatgagtgacgagtttgtggactcctttaagaagggacttcctcgcccgaagagcgcgggcacagcaacgcagatgcggcaaagctccagctggacgcgagtcttccagtcctggtgggatcggaacttgggcaggggaagctccgccccctcccagtga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - keratin associated protein 4-12 - nuclear transcription factor Y, beta - RAB27B, member RAS oncogene family - coiled-coil domain containing 90B |