DAZAP2-DAZ associated protein 2 Gene

View larger

DAZAP2-DAZ associated protein 2 Gene

Reference: PTXBC002334

Condition: New product

Print

Data sheet of DAZAP2-DAZ associated protein 2 Gene

Brand	ProteoGenix
Product type	DNA & cDNA
Origin species	Human

More info about DAZAP2-DAZ associated protein 2 Gene

Brand:	ProteoGenix
Proteogenix catalog:	PTXBC002334
Product type:	DNA & cDNA
Ncbi symbol:	DAZAP2
Origin species:	Human
Product name:	DAZAP2-DAZ associated protein 2 Gene
Size:	2ug
Accessions:	BC002334
Gene id:	9802
Gene description:	DAZ associated protein 2
Synonyms:	PRTB; DAZ-associated protein 2; deleted in azoospermia associated protein 2; proline-rich transcript in brain; proline-rich transcript, brain-expressed protein; DAZ associated protein 2
Sequence primers:	Forward primer M13R (5'â†’3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â†’3'): TAATACGACTCACTATAGG
Orf sequence:	atgaacagcaaaggtcaatatccaacacagccaacctaccctgtgcagcctcctgggaatccagtataccctcagaccttgcatcttcctcaggctccaccctataccgatgctccacctgcctactcagagctctatcgtccgagctttgtgcacccaggggctgccacagtccccaccatgtcagccgcatttcctggagcctctctgtatcttcccatggcccagtctgtggctgttgggcctttaggttccacaatccccatggcttattatccagtcggtcccatctatccacctggctccacagtgctggtggaaggagggtatgatgcaggtgccagatttggagctggggctactgctggcaacattcctcctccacctcctggatgccctcccaatgctgctcagcttgcagtcatgcagggagccaacgtcctcgtaactcagcggaaggggaacttcttcatgggtggttcagatggtggctacaccatctggtga
Vector:	pDONR223
Delivery lead time in business days in europe:	10-12 days
Storage:	-20â„ƒ
Delivery condition:	Blue Ice
Related products:	- transmembrane protein 44 - SCAN domain containing 1 - acireductone dioxygenase 1 - high-mobility group box 4

Reviews

Be the first to write your review !

Buy DAZAP2-DAZ associated protein 2 Gene now