Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000689 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | PPIA |
| Origin species: | Human |
| Product name: | PPIA-peptidylprolyl isomerase A (cyclophilin A) Gene |
| Size: | 2ug |
| Accessions: | BC000689 |
| Gene id: | 5478 |
| Gene description: | peptidylprolyl isomerase A (cyclophilin A) |
| Synonyms: | CYPH; HEL-S-69p; peptidyl-prolyl cis-trans isomerase A; PPIase A; T cell cyclophilin; cyclosporin A-binding protein; epididymis secretory sperm binding protein Li 69p; peptidylprolyl isomerase A (cyclophilin A); rotamase A; peptidylprolyl isomerase A |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcaaccccaccgtgttcttcgacattgccgtcgacggcgagcccttgggccgcgtctcctttgagctgtttgcagacaaggtcccaaagacagcagaaaattttcgtgctctgagcactggagagaaaggatttggttataagggttcctgctttcacagaattattccagggtttatgtgtcagggtggtgacttcacacgccataatggcactggtggcaagtccatctatggggagaaatttgaagatgagaacttcatcctaaagcatacgggtcctggcatcttgtccatggcaaatgctggacccaacacaaatggttcccagtttttcatctgcactgccaagactgagtggttggatggcaagcatgtggtgtttggcaaagtgaaagaaggcatgaatattgtggaggccatggagcgctttgggtccaggaatggcaagaccagcaagaagatcaccattgctgactgtggacaactcgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RAB, member of RAS oncogene family-like 4 - DEAD (Asp-Glu-Ala-Asp) box polypeptide 54 - eukaryotic translation initiation factor 6 - FGGY carbohydrate kinase domain containing |