Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of CD247-CD247 molecule Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CD247-CD247 molecule Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025703 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CD247 |
| Origin species: | Human |
| Product name: | CD247-CD247 molecule Gene |
| Size: | 2ug |
| Accessions: | BC025703 |
| Gene id: | 919 |
| Gene description: | CD247 molecule |
| Synonyms: | CD247 molecule; CD247 antigen, zeta subunit; CD3-ZETA; CD3H; CD3Q; CD3Z; IMD25; T3Z; TCRZ; T-cell surface glycoprotein CD3 zeta chain; CD3Z antigen, zeta polypeptide (TiT3 complex); CD3zeta chain; T-cell antigen receptor complex, zeta subunit of CD3; T-cell receptor T3 zeta chain; TCR zeta chain |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagtggaaggcgcttttcaccgcggccatcctgcaggcacagttgccgattacagaggcacagagctttggcctgctggatcccaaactctgctacctgctggatggaatcctcttcatctatggtgtcattctcactgccttgttcctgagagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgcagagaaggaagaaccctcaggaaggcctgtacaatgaactgcagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - glutaredoxin 3 - visinin-like 1 - tetraspanin 3 - sorting nexin 6 |