Cart 2 Product Products 216,18 € (empty)
-
1 x C21orf49-c...113,40 € -
No products
To be determined Shipping
216,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 216,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 216,18 €
View larger 
RARRES2-retinoic acid receptor responder (tazarotene induced) 2 Gene
PTXBC000069
New product
Data sheet of RARRES2-retinoic acid receptor responder (tazarotene induced) 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RARRES2-retinoic acid receptor responder (tazarotene induced) 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000069 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RARRES2 |
| Origin species: | Human |
| Product name: | RARRES2-retinoic acid receptor responder (tazarotene induced) 2 Gene |
| Size: | 2ug |
| Accessions: | BC000069 |
| Gene id: | 5919 |
| Gene description: | retinoic acid receptor responder (tazarotene induced) 2 |
| Synonyms: | HP10433; TIG2; retinoic acid receptor responder protein 2; RAR-responsive protein TIG2; chemerin; retinoic acid receptor responder (tazarotene induced) 2; tazarotene-induced gene 2 protein; retinoic acid receptor responder 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcgacggctgctgatccctctggccctgtggctgggcgcggtgggcgtgggcgtcgccgagctcacggaagcccagcgccggggcctgcaggtggccctggaggaatttcacaagcacccgcccgtgcagtgggccttccaggagaccagtgtggagagcgccgtggacacgcccttcccagctggaatatttgtgaggctggaatttaagctgcagcagacaagctgccggaagagggactggaagaaacccgagtgcaaagtcaggcccaatgggaggaaacggaaatgcctggcctgcatcaaactgggctctgaggacaaagttctgggccggttggtccactgccccatagagacccaagttctgcgggaggctgaggagcaccaggagacccagtgcctcagggtgcagcgggctggtgaggacccccacagcttctacttccctggacagttcgccttctccaaggccctgccccgcagctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chorionic somatomammotropin hormone 1 (placental lactogen) - transmembrane emp24 protein transport domain containing 5 - nicotinate phosphoribosyltransferase domain containing 1 - RRS1 ribosome biogenesis regulator homolog (S. cerevisiae) |