Cart 24 Product Products 3 549,97 € (empty)
-
1 x C-Reactive...544,00 € -
1 x M6PR-manno...121,50 € -
-
1 x SPANXE-SPA...113,40 € -
1 x ARC-activi...121,50 € -
1 x SMCP-sperm...113,40 € -
-
1 x TM4SF18-tr...113,40 € -
1 x GC-group-s...121,50 € -
1 x NEU4-siali...121,50 € -
1 x TMEM31-tra...113,40 € -
1 x PLA2G2D-ph...113,40 € -
1 x C20orf177-...121,50 € -
1 x WDR53-WD...121,50 € -
1 x CCL22-chem...113,40 € -
1 x PRRG4-prol...113,40 € -
1 x MGC87631-s...113,40 € -
-
-
1 x POLB-polym...121,50 € -
1 x ANXA8-anne...121,50 € -
-
-
1 x ATPAF2-ATP...121,50 €
No products
To be determined Shipping
3 549,97 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 24 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 3 549,97 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 3 549,97 €
View larger 
Data sheet of GADD45G-growth arrest and DNA-damage-inducible, gamma Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GADD45G-growth arrest and DNA-damage-inducible, gamma Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000465 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GADD45G |
| Origin species: | Human |
| Product name: | GADD45G-growth arrest and DNA-damage-inducible, gamma Gene |
| Size: | 2ug |
| Accessions: | BC000465 |
| Gene id: | 10912 |
| Gene description: | growth arrest and DNA-damage-inducible, gamma |
| Synonyms: | CR6; DDIT2; GADD45gamma; GRP17; growth arrest and DNA damage-inducible protein GADD45 gamma; DDIT-2; DNA damage-inducible transcript 2 protein; GADD45-gamma; cytokine-responsive protein CR6; gadd-related protein, 17 kD; growth arrest and DNA damage inducible gamma |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgactctggaagaagtccgcggccaggacacagttccggaaagcacagccaggatgcagggtgccgggaaagcgctgcatgagttgctgctgtcggcgcagcgtcagggctgcctcactgccggcgtctacgagtcagccaaagtcttgaacgtggaccccgacaatgtgaccttctgtgtgctggctgcgggtgaggaggacgagggcgacatcgcgctgcagatccattttacgctgatccaggctttctgctgcgagaacgacatcgacatagtgcgcgtgggcgatgtgcagcggctggcggctatcgtgggcgccggcgaggaggcgggtgcgccgggcgacctgcactgcatcctcatttcgaaccccaacgaggacgcctggaaggatcccgccttggagaagctcagcctgttttgcgaggagagccgcagcgttaacgactgggtgcccagcatcaccctccccgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ADP-ribosylation factor-like 2 binding protein - family with sequence similarity 158, member A - monocyte to macrophage differentiation-associated - leucine-rich repeats and IQ motif containing 1 |