Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene
PTXBC000651
New product
Data sheet of SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000651 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SLC1A7 |
| Origin species: | Human |
| Product name: | SLC1A7-solute carrier family 1 (glutamate transporter), member 7 Gene |
| Size: | 2ug |
| Accessions: | BC000651 |
| Gene id: | 6512 |
| Gene description: | solute carrier family 1 (glutamate transporter), member 7 |
| Synonyms: | AAAT; excitatory amino acid transporter 5; excitatory amino acid transporter 5 (retinal glutamate transporter); retinal glutamate transporter; solute carrier family 1 (glutamate transporter), member 7; solute carrier family 1 member 7 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgccgcatgccatcttggcacgggggagggacgtgtgcaggcggaatggactcctcatcctgtctgtgctgtctgtcatcgtgggctgcctcctcggcttcttcttgaggacccggcgcctctcaccacaggaaattagttacttccagttccctggagagctcctgatgaggatgctgaagatgatgatcctgccactggtggtctccagcttgatgtccggacttgcctccctggatgccaagacctctagccgcctgggcgtcctcaccgtggcgtactacctgtggaccaccttcatggctgtcatcgtgggcatcttcatggtctccatcatccacccaggcagcgcggcccagaaggagaccacggagcagagtgggaagcccatcatgagctcagccgatgccctgttggacctcatccggcagaaagaagaaagttggaggaacggaccaaagggtcctggctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - protein phosphatase 1, regulatory (inhibitor) subunit 1A - thioredoxin domain containing 12 (endoplasmic reticulum) - solute carrier family 31 (copper transporters), member 1 - MIS12, MIND kinetochore complex component, homolog (yeast) |