Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018345 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MKNK2 |
| Origin species: | Human |
| Product name: | MKNK2-MAP kinase interacting serine/threonine kinase 2 Gene |
| Size: | 2ug |
| Accessions: | BC018345 |
| Gene id: | 2872 |
| Gene description: | MAP kinase interacting serine/threonine kinase 2 |
| Synonyms: | GPRK7; MNK2; MAP kinase-interacting serine/threonine-protein kinase 2; G protein-coupled receptor kinase 7; MAP kinase signal-integrating kinase 2; MAPK signal-integrating kinase 2; MAP kinase interacting serine/threonine kinase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggccccggaggtagtggaggccttcagcgaggaggctagcatctacgacaagcgctgcgacctgtggagcctgggcgtcatcttgtatatcctactcagcggctacccgcccttcgtgggccgctgtggcagcgactgcggctgggaccgcggcgaggcctgccctgcctgccagaacatgctgtttgagagcatccaggagggcaagtacgagttccccgacaaggactgggcccacatctcctgcgctgccaaagacctcatctccaagctgctggtccgtgacgccaagcagaggctgagtgccgcccaagtcctgcagcacccctgggttcaggggtgcgccccggagaacaccttgcccactcccatggtcctgcagaggtgggacagtcacttcctcctccctccccacccctgtcgcatccacgtgcgacctggaggactggtcagaaccgttactgtgaatgagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tumor necrosis factor, alpha-induced protein 8 - acyl-CoA synthetase medium-chain family member 5 - small nuclear ribonucleoprotein polypeptide B'' - TCF3 (E2A) fusion partner (in childhood Leukemia) |