Cart 7 Product Products 963,77 € (empty)
-
1 x ZNF616-zin...113,40 € -
1 x MAB21L1-ma...121,50 € -
1 x RNASE3-rib...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x EIF2B2-euk...121,50 € -
1 x SREC-II...259,07 € -
1 x CXXC5-CXXC...121,50 €
No products
To be determined Shipping
963,77 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 7 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 963,77 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 963,77 €
Data sheet of MRPL50-mitochondrial ribosomal protein L50 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRPL50-mitochondrial ribosomal protein L50 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC032008 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRPL50 |
| Origin species: | Human |
| Product name: | MRPL50-mitochondrial ribosomal protein L50 Gene |
| Size: | 2ug |
| Accessions: | BC032008 |
| Gene id: | 54534 |
| Gene description: | mitochondrial ribosomal protein L50 |
| Synonyms: | MRP-L50; 39S ribosomal protein L50, mitochondrial; L50mt; mitochondrial 39S ribosomal protein L50; mitochondrial ribosomal protein L50 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggcgcgatctgtgtcgggcattaccagaagagtcttcatgtggacagtctcagggacaccatgtagagaattttggtctcgattcagaaaagagaaagagccagtggttgttgagacagtagaagagaaaaaggaacctatcctagtgtgtccacctttacgaagccgagcatacacaccacctgaagatctccagagtcgtttggaatcttacgttaaagaagtttttggttcatctcttcctagtaattggcaagacatctccctggaagatagtcgtctaaagttcaatcttctggctcatttagctgatgacttgggtcatgtagtccctaactccagactccaccagatgtgcagggttagagatgtttttgatttctataatgtccctattcaagatagatctaaatttgatgaactcagtgcgagtaatctgccccccaatttgaaaatcacttggagttactaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein L13A pseudogene - chromosome 1 open reading frame 52 - chromosome 1 open reading frame 43 - mitochondrial ribosomal protein L11 |