PTXBC010739
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC010739 |
Product type: | DNA & cDNA |
Ncbi symbol: | COPS7B |
Origin species: | Human |
Product name: | COPS7B-COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) Gene |
Size: | 2ug |
Accessions: | BC010739 |
Gene id: | 64708 |
Gene description: | COP9 constitutive photomorphogenic homolog subunit 7B (Arabidopsis) |
Synonyms: | CSN7B; SGN7b; COP9 signalosome complex subunit 7b; COP9 constitutive photomorphogenic homolog subunit 7B; JAB1-containing signalosome subunit 7b; signalosome subunit 7b; COP9 signalosome subunit 7B |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaagtgtatcccctactccgtgttgctgaaagacctggagatgcggaatctccgggaactagaagaccttatcattgaggctgtctacactgacatcatccagggcaagctggaccagcgaaaccagctgctggaagtggatttctgcattggccgtgacatccgaaagaaggatatcaataatattgtcaagaccctgcatgaatggtgtgatggctgtgaagcagttctactgggcatcgagcagcaagttctgagagccaaccagtacaaagagaaccacaaccgaactcagcagcaggtagaagcagaggttaccaacatcaagaagacactcaaagccaccgcatcctcctcggctcaggagatggagcagcagctggctgaacgggagtgtccccctcacgctgagcagaggcagcccaccaagaagatgtccaaagtgaaaggtctggtctccagccgccactag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - processing of precursor 5, ribonuclease P/MRP subunit (S. cerevisiae) - processing of precursor 4, ribonuclease P/MRP subunit (S. cerevisiae) - potassium voltage-gated channel, subfamily H (eag-related), member 6 - solute carrier family 2 (facilitated glucose transporter), member 9 |