Cart 1 Product Products 113,40 € (empty)
-
1 x JOSD1-Jose...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
Data sheet of IL1F5-interleukin 1 family, member 5 (delta) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL1F5-interleukin 1 family, member 5 (delta) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC024747 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL1F5 |
| Origin species: | Human |
| Product name: | IL1F5-interleukin 1 family, member 5 (delta) Gene |
| Size: | 2ug |
| Accessions: | BC024747 |
| Gene id: | 26525 |
| Gene description: | interleukin 1 family, member 5 (delta) |
| Synonyms: | IL1F5 (Canonical product IL-1F5a); IL1F5; FIL1; FIL1(DELTA); FIL1D; IL-36Ra; IL1HY1; IL1L1; IL1RP3; IL36RA; PSORP; PSORS14; interleukin-36 receptor antagonist protein; IL-1 related protein 3; IL-1F5 (IL-1HY1, FIL1-delta, IL-1RP3, IL-1L1, IL-1-delta); IL-1ra homolog 1; interleukin 1 family, member 5 (delta); interleukin-1 HY1; interleukin-1 receptor antagonist homolog 1; interleukin-1-like protein 1; interleukin 36 receptor antagonist |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtcctgagtggggcgctgtgcttccgaatgaaggactcggcattgaaggtgctttatctgcataataaccagcttctagctggagggctgcatgcagggaaggtcattaaaggtgaagagatcagcgtggtccccaatcggtggctggatgccagcctgtcccccgtcatcctgggtgtccagggtggaagccagtgcctgtcatgtggggtggggcaggagccgactctaacactagagccagtgaacatcatggagctctatcttggtgccaaggaatccaagagcttcaccttctaccggcgggacatggggctcacctccagcttcgagtcggctgcctacccgggctggttcctgtgcacggtgcctgaagccgatcagcctgtcagactcacccagcttcccgagaatggtggctggaatgcccccatcacagacttctacttccagcagtgtgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - RNA binding motif (RNP1, RRM) protein 3 - chromosome 15 open reading frame 15 - chromosome 19 open reading frame 41 - chromosome 19 open reading frame 43 |