MAX-MYC associated factor X Gene View larger

MAX-MYC associated factor X Gene

PTXBC025685

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MAX-MYC associated factor X Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MAX-MYC associated factor X Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC025685
Product type: DNA & cDNA
Ncbi symbol: MAX
Origin species: Human
Product name: MAX-MYC associated factor X Gene
Size: 2ug
Accessions: BC025685
Gene id: 4149
Gene description: MYC associated factor X
Synonyms: protein max; bHLHd4; class D basic helix-loop-helix protein 4; MYC associated factor X
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgagcgataacgatgacatcgaggtggagagcgacgctgacaaacgggctcatcataatgcactggaacgaaaacgtagggaccacatcaaagacagctttcacagtttgcgggactcagtcccatcactccaaggagagaaggcatcccgggcccaaatcctagacaaagccacagaatatatccagtatatgcgaaggaaaaaccacacacaccagcaagatattgacgacctcaagcggcagaatgctcttctggagcagcaagtccgtgcactggagaaggcgaggtcaagtgcccaactgcagaccaactacccctcctcagacaacagcctctacaccaacgccaagggcagcaccatctctgccttcgatgggtgctcggactccagctcggagtctgagcctgaagagccccaaagcaggaagaagctccggatggaggccagctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - PDZ and LIM domain 3
- ribosomal protein L19
- ribosomal protein L13
- CD99 molecule-like 2

Reviews

Buy MAX-MYC associated factor X Gene now

Add to cart