No products
Prices are tax excluded
PTXBC030237
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC030237 |
Product type: | DNA & cDNA |
Ncbi symbol: | SLC22A18AS |
Origin species: | Human |
Product name: | SLC22A18AS-solute carrier family 22 (organic cation transporter), member 18 antisense Gene |
Size: | 2ug |
Accessions: | BC030237 |
Gene id: | 5003 |
Gene description: | solute carrier family 22 (organic cation transporter), member 18 antisense |
Synonyms: | BWR1B; BWSCR1B; ORCTL2S; SLC22A1LS; p27-BWR1B; beckwith-Wiedemann syndrome chromosomal region 1 candidate gene B protein; Beckwith-Wiedemann region 1B; Beckwith-Wiedemann syndrome chromosome region 1, candidate b; organic cation transporter-like 2 antisense; organic cation transporter-like protein 2 antisense protein; p27-Beckwith-Wiedemann region 1 B; solute carrier family 22 (organic cation transporter), member 1-like antisense; solute carrier family 22 (organic cation transporter), member 18 antisense; solute carrier family 22 member 1-like antisense protein; solute carrier family 22 member 18 antisense protein; solute carrier family 22 member 18 antisense |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgcggtgtgcagagggtgcttggtggttctctcctgatggccccgcagggtctgcagcctccatctggccagcagagggcgcagaaggactgcctgggcagctcggacgtgaccgcctggaagtggtgtacagcgttcctgacaacgttcccggccaaaacgggtcccgccgcccacttgtgtgcaagataactggaaaatgtctttctgtgtgctccgaggagaatgcaaaggctggtggatgtagtgcctttcctctactgctctctcagctgggggcaagaatgacaggacgtgaacatgcacacaagggcccggaactcacgacccccgacagcggtctcccccgcccccccaaccccgcgcttgcaggatttagggcactagcacagcacagtccaccccttgggactagcaccccctccgcagttctgctctctgcagcaacatag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 1 - sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae) - sirtuin (silent mating type information regulation 2 homolog) 2 (S. cerevisiae) - elongation of very long chain fatty acids (FEN1/Elo2, SUR4/Elo3, yeast)-like 3 |