Cart 9 Product Products 1 198,67 € (empty)
-
1 x ZNF616-zin...113,40 € -
1 x MAB21L1-ma...121,50 € -
1 x RNASE3-rib...113,40 € -
1 x HLA-DQA1-m...113,40 € -
1 x EIF2B2-euk...121,50 € -
1 x SREC-II...259,07 € -
1 x CXXC5-CXXC...121,50 € -
1 x HLA-DPA1-m...113,40 € -
1 x TGDS-TDP-g...121,50 €
No products
To be determined Shipping
1 198,67 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 9 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 198,67 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 198,67 €
Data sheet of SULF2-sulfatase 2 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SULF2-sulfatase 2 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC020962 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SULF2 |
| Origin species: | Human |
| Product name: | SULF2-sulfatase 2 Gene |
| Size: | 2ug |
| Accessions: | BC020962 |
| Gene id: | 55959 |
| Gene description: | sulfatase 2 |
| Synonyms: | HSULF-2; extracellular sulfatase Sulf-2; sulfatase 2 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccaggcctcacgtgcttcacccacgacaaccagcactggcagacggcgcctttctggacactggggcctttctgtgcctgcaccagcgccaacaataacacgtactggtgcatgaggaccatcaatgagactcacaatttcctcttctgtgaatttgcaactggcttcctagagtactttgatctcaacacagacccctaccagctgatgaatgcagtgaacacactggacagggatgtcctcaaccagctacacgtacagctcatggagctgaggagctgcaagggttacaagcagtgtaacccccggactcgaaacatggacctgggacttaaagatggaggaagctatgagcaatacaggcagtttcagcgtcgaaagtggccagaaatgaagagaccttcttccaaatcactgggacaactgtgggaaggctgggaaggttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - cytohesin 3 - glyoxalase I - vasohibin 1 - homeobox B6 |