PTXBC013569
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC013569 |
Product type: | DNA & cDNA |
Ncbi symbol: | PYCARD |
Origin species: | Human |
Product name: | PYCARD-PYD and CARD domain containing Gene |
Size: | 2ug |
Accessions: | BC013569 |
Gene id: | 29108 |
Gene description: | PYD and CARD domain containing |
Synonyms: | CARD5; TMS; TMS-1; TMS1; apoptosis-associated speck-like protein containing a CARD; caspase recruitment domain-containing protein 5; target of methylation-induced silencing 1; PYD and CARD domain containing |
Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
Orf sequence: | atggacgccttggacctcaccgacaagctggtcagcttctacctggagacctacggcgccgagctcaccgctaacgtgctgcgcgacatgggcctgcaggagatggccgggcagctgcaggcggccacgcaccagggctctggagccgcgccagctgggatccaggcccctcctcagtcggcagccaagccaggcctgcactttatagaccagcaccgggctgcgcttatcgcgagggtcacaaacgttgagtggctgctggatgctctgtacgggaaggtcctgacggatgagcagtaccaggcagtgcgggccgagcccaccaacccaagcaagatgcggaagctcttcagtttcacaccagcctggaactggacctgcaaggacttgctcctccaggccctaagggagtcccagtcctacctggtggaggacctggagcggagctga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20℃ |
Delivery condition: | Blue Ice |
Related products: | - ubiquitin specific peptidase 47 - synovial sarcoma, X breakpoint 2 - ADP-ribosylation factor-like 4A - ADP-ribosylation factor-like 4D |