Cart 5 Product Products 910,28 € (empty)
-
1 x TMEM69-tra...113,40 € -
1 x ATP1B3-ATP...121,50 € -
1 x ATF1-activ...121,50 € -
1 x ZC3H8-zinc...121,50 € -
No products
To be determined Shipping
910,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 5 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 910,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 910,28 €
Data sheet of LYZ-lysozyme (renal amyloidosis) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LYZ-lysozyme (renal amyloidosis) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004147 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LYZ |
| Origin species: | Human |
| Product name: | LYZ-lysozyme (renal amyloidosis) Gene |
| Size: | 2ug |
| Accessions: | BC004147 |
| Gene id: | 4069 |
| Gene description: | lysozyme (renal amyloidosis) |
| Synonyms: | LYZF1; LZM; lysozyme C; 1,4-beta-N-acetylmuramidase C; c-type lysozyme; lysozyme F1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaggctctcattgttctggggcttgtcctcctttctgttacggtccagggcaaggtctttgaaaggtgtgagttggccagaactctgaaaagattgggaatggatggctacaggggaatcagcctagcaaactggatgtgtttggccaaatgggagagtggttacaacacacgagctacaaactacaatgctggagacagaagcactgattatgggatatttcagatcaatagccgctactggtgtaatgatggcaaaaccccaggagcagttaatgcctgtcatttatcctgcagtgctttgctgcaagataacatcgctgatgctgtagcttgtgcaaagagggttgtccgtgatccacaaggcattagagcatgggtggcatggagaaatcgttgtcaaaacagagatgtccgtcagtatgttcaaggttgtggagtgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - zinc finger, matrin type 4 - zinc finger, matrin type 5 - kinesin family member 16B - PDGFA associated protein 1 |