Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of IL20RB-interleukin 20 receptor beta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IL20RB-interleukin 20 receptor beta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033292 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IL20RB |
| Origin species: | Human |
| Product name: | IL20RB-interleukin 20 receptor beta Gene |
| Size: | 2ug |
| Accessions: | BC033292 |
| Gene id: | 53833 |
| Gene description: | interleukin 20 receptor beta |
| Synonyms: | DIRS1; FNDC6; IL-20R2; interleukin-20 receptor subunit beta; IL-20 receptor subunit beta; IL-20R-beta; IL-20RB; fibronectin type III domain containing 6; interleukin 20 receptor beta subunit; interleukin-20 receptor II; interleukin 20 receptor subunit beta |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaagcatctcttgatgtggagcccagtgatcgcgcctggagaaacagtgtactattctgtcgaataccagggggagtacgagagcctgtacacgagccacatctggatccccagcagctggtgctcactcactgaaggtcctgagtgtgatgtcactgatgacatcacggccactgtgccatacaaccttcgtgtcagggccacattgggctcacagacctcagcctggagcatcctgaagcatccctttaatagaaactcaaccatccttacccgacctgggatggagatcaccaaagatggcttccacctggttattgagctggaggacctggggccccagtttgagttccttgtggcctactggaggagggagcctggtgccgaggagaggccattcccctggtactggccctgtttgcctttgttggcttcatgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - phospholipase A2, group XVI - inducible T-cell co-stimulator - transmembrane protein 185A - Nipped-B homolog (Drosophila) |