MPZL1-myelin protein zero-like 1 Gene View larger

MPZL1-myelin protein zero-like 1 Gene

PTXBC019890

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of MPZL1-myelin protein zero-like 1 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about MPZL1-myelin protein zero-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC019890
Product type: DNA & cDNA
Ncbi symbol: MPZL1
Origin species: Human
Product name: MPZL1-myelin protein zero-like 1 Gene
Size: 2ug
Accessions: BC019890
Gene id: 9019
Gene description: myelin protein zero-like 1
Synonyms: MPZL1b; PZR1b; PZRa; PZRb; myelin protein zero-like protein 1; immunoglobulin family transmembrane protein; protein zero related; myelin protein zero like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgacacctggaggcctgttcctcccttaccactcccttccccagcccgacttcttggcctcctgcccaaccagacacctcaaactctgtcagtgccctggcattctggcagagaatcctcaccagttctcaccaaccttccccccaggcaagggcagctgccagcatggtgctctgccaggacaggtttccctgaaggaagctgctcacactgagatgagcctctcagggcaggacctcttcccaagccctgcacacccacccctgcagcccttttggctccccttttccctgtgcctcagcactcctttcctggttgcagataacgaactaaggttgcctaaagggcagatctgccctctccatgtcttcgtcctggcaaacagggtcgtcttaaaattatgcgctaattctgtatgggagcactcaaaaggcattacttag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - lysozyme (renal amyloidosis)
- zinc finger, matrin type 4
- zinc finger, matrin type 5
- kinesin family member 16B

Reviews

Buy MPZL1-myelin protein zero-like 1 Gene now

Add to cart