Cart 10 Product Products 1 388,30 € (empty)
-
1 x RGS1...259,07 € -
1 x FAM163A-fa...113,40 € -
1 x TMPO-thymo...121,50 € -
1 x RASSF8-Ras...121,50 € -
-
1 x TSPAN12-te...121,50 € -
1 x PFDN2-pref...113,40 € -
1 x GPR52-G...121,50 € -
1 x CTSG-cathe...113,40 € -
No products
To be determined Shipping
1 388,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 10 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 388,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 388,30 €
Data sheet of GPX1-glutathione peroxidase 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GPX1-glutathione peroxidase 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000742 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GPX1 |
| Origin species: | Human |
| Product name: | GPX1-glutathione peroxidase 1 Gene |
| Size: | 2ug |
| Accessions: | BC000742 |
| Gene id: | 2876 |
| Gene description: | glutathione peroxidase 1 |
| Synonyms: | GPXD; GSHPX1; glutathione peroxidase 1; GSHPx-1; cellular glutathione peroxidase |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaacgagctgcagcggcgcctcggaccccggggcctggtggtgctcggcttcccgtgcaaccagtttgggcatcaggagaacgccaagaacgaagagattctgaattccctcaagtacgtccggcctggtggtgggttcgagcccaacttcatgctcttcgagaagtgcgaggtgaacggtgcgggggcgcaccctctcttcgccttcctgcgggaggccctgccagctcccagcgacgacgccaccgcgcttatgaccgaccccaagctcatcacctggtctccggtgtgtcgcaacgatgttgcctggaactttgagaagttcctggtgggccctgacggtgtgcccctacgcaggtacagccgccgcttccagaccattgacatcgagcctgacatcgaagccctgctgtctcaagggcccagctgtgcctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - ribosomal protein S27a - LSM domain containing 1 - transmembrane protein 9 - ribosomal protein L13a |