PTXBC011517
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC011517 |
Product type: | DNA & cDNA |
Ncbi symbol: | BAALC |
Origin species: | Human |
Product name: | BAALC-brain and acute leukemia, cytoplasmic Gene |
Size: | 2ug |
Accessions: | BC011517 |
Gene id: | 79870 |
Gene description: | brain and acute leukemia, cytoplasmic |
Synonyms: | brain and acute leukemia cytoplasmic protein; brain and acute leukemia, cytoplasmic |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgggctgcggtgggagccgggcggatgccatcgagccccgctactacgagagctggacccgggagacagaatccacctggctcacctacaccgactcggacgcgccgcccagcgccgccgccccggacagcggccccgaagcgggcggcctgcactcgggcatgctggaagatggactgccctccaatggtgtgccccgatctacagccccaggtggaatacccaacccagagaagaagacgaactgtgagacccagtgcccaaatccccagagcctcagctcaggccctctgacccagaaacagaatggccttcagaccacagaggctaaaagagatgctaagagaatgcctgcaaaagaagtcaccattaatgtaacagatagcatccaacagatggacagaagtcgaagaatcacaaagaactgtgtcaactag |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - NHP2 ribonucleoprotein homolog (yeast) - malignant T cell amplified sequence 1 - GINS complex subunit 2 (Psf2 homolog) - prolyl 4-hydroxylase, beta polypeptide |