Cart 1 Product Products 113,40 € (empty)
-
1 x RAB38-RAB3...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of SMAD3-SMAD family member 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SMAD3-SMAD family member 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000414 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SMAD3 |
| Origin species: | Human |
| Product name: | SMAD3-SMAD family member 3 Gene |
| Size: | 2ug |
| Accessions: | BC000414 |
| Gene id: | 4088 |
| Gene description: | SMAD family member 3 |
| Synonyms: | HSPC193; HsT17436; JV15-2; LDS1C; LDS3; MADH3; mothers against decapentaplegic homolog 3; MAD homolog 3; MAD, mothers against decapentaplegic homolog 3; SMA- and MAD-related protein 3; SMAD, mothers against DPP homolog 3; hMAD-3; hSMAD3; mad homolog JV15-2; mad protein homolog; mad3; mothers against DPP homolog 3; SMAD family member 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcatgcacgtatgtaagtaatctggggaagaagcaaagatctgtttcattcttagcctcaggcctcatgagggtctccacagggccggagctcaggttacaccactccttcgtccttacaggagatgtagggagaagaatctgcaggctgcttgtaggactgttcaccaagggggataccagcagcaagagagtgcacccgtttagccctggaccctgtttcttactgtgtgacttggctagagttgggagttcccccaaaataaacgtgtccccattttaccagaaccaaacctcaacacagcgaagctgtactgtctttgtgtggcaaagatgttcccttgtaggcccctttcaggtaaccgtcttcacaatgtattttcatcacagtttaaggagcatcagccgcttctcaagtgggtag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - thioredoxin-like 4A - hemoglobin, epsilon 1 - bridging integrator 3 - exosome component 3 |