Cart 2 Product Products 658,56 € (empty)
No products
To be determined Shipping
658,56 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 658,56 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 658,56 €
View larger 
TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene
PTXBC011999
New product
Data sheet of TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC011999 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TGS1 |
| Origin species: | Human |
| Product name: | TGS1-trimethylguanosine synthase homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC011999 |
| Gene id: | 96764 |
| Gene description: | trimethylguanosine synthase homolog (S. cerevisiae) |
| Synonyms: | NCOA6IP; PIMT; PIPMT; trimethylguanosine synthase; CLL-associated antigen KW-2; PRIP-interacting protein with methyltransferase motif; cap-specific guanine-N2 methyltransferase; hepatocellular carcinoma-associated antigen 137; nuclear receptor coactivator 6-interacting protein; trimethylguanosine synthase 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgagagtgattgccattgatatcgatcctgttaagattgcccttgctcgcaataatgcagaagtttatgggatagcagataagatagagttcatctgtggagatttcttgctgctggcttcttttttaaaggctgatgttgtgttcctcagcccaccttggggagggccagactatgccactgcagagacctttgacattagaacaatgatgtctcctgatggctttgaaattttcagactttctaagaagatcactaataatattgtttattttcttccaagaaatgctgatattgaccaggtggcatccttagctgggcctggagggcaagtggaaatagaacagaacttccttaacaacaaattgaagacaatcactgcatattttggtgacctaattcgaagaccagcctctgaaacctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - actin related protein 2/3 complex, subunit 5-like - CCHC-type zinc finger, nucleic acid binding protein - holocytochrome c synthase (cytochrome c heme-lyase) - basic leucine zipper transcription factor, ATF-like |