Cart 1 Product Products 113,40 € (empty)
-
1 x HIST1H4A-h...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of DKFZP434K028-hypothetical LOC26070 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DKFZP434K028-hypothetical LOC26070 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC021187 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DKFZP434K028 |
| Origin species: | Human |
| Product name: | DKFZP434K028-hypothetical LOC26070 Gene |
| Size: | 2ug |
| Accessions: | BC021187 |
| Gene id: | 26070 |
| Gene description: | hypothetical LOC26070 |
| Synonyms: | uncharacterized LOC26070 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttcaggccttgcacacagaaccacagaacatgctcaacaagccccctaagcttaggggcactgacctaccctggggactagtaatcttcaagatgagaaagcggaggcacagcggtgccctgatacggccaagagaagcactgtgggtaagcaggagagctaggaacagaccccagctgccctcgctggcgaatgcacagaaccattacatcatcctaccccgagacccaaccaagaggtacccacaccccgtggcagccggggctgaaggcctggagataggagaggaggccccacatactccagcacccaaggcaatgagagaaactgaggcccaggaaggtgctaggtccgtgaagaggaaggtgggaagggctgggcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Niemann-Pick disease, type C2 - collagen, type XX, alpha 1 - receptor accessory protein 6 - stromal cell-derived factor 2 |