No products
Prices are tax excluded
PTXBC001716
New product
This product is no longer in stock
Availability date:
Brand | ProteoGenix |
Product type | DNA & cDNA |
Origin species | Human |
Brand: | ProteoGenix |
Proteogenix catalog: | PTXBC001716 |
Product type: | DNA & cDNA |
Ncbi symbol: | PAIP2 |
Origin species: | Human |
Product name: | PAIP2-poly(A) binding protein interacting protein 2 Gene |
Size: | 2ug |
Accessions: | BC001716 |
Gene id: | 51247 |
Gene description: | poly(A) binding protein interacting protein 2 |
Synonyms: | PAIP-2; PAIP2A; polyadenylate-binding protein-interacting protein 2; PABC1-interacting protein 2; PABP-interacting protein 2; polyA-binding protein-interacting protein 2; poly(A) binding protein interacting protein 2 |
Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
Orf sequence: | atgaaagatccaagtcgcagcagtactagcccaagcatcatcaatgaagatgtgattattaacggtcattctcatgaagatgacaatccatttgcagagtacatgtggatggaaaatgaagaagaattcaacagacaaatagaagaggagttatgggaagaagaatttattgaacgctgtttccaagaaatgctggaagaggaagaagagcatgaatggtttattccagctcgagatctcccacaaactatggaccaaatccaagaccagtttaatgaccttgttatcagtgatggctcttctctggaagatcttgtggtcaagagcaatctgaatccaaatgcaaaggagtttgttcctggggtgaagtacggaaatatttga |
Vector: | pDONR223 |
Delivery lead time in business days in europe: | 10-12 days |
Storage: | -20â |
Delivery condition: | Blue Ice |
Related products: | - peptidylprolyl isomerase (cyclophilin)-like 4 - MAD2 mitotic arrest deficient-like 1 (yeast) - zinc finger CCHC-type and RNA binding motif 1 - family with sequence similarity 60, member A |