Cart 2 Product Products 224,28 € (empty)
-
-
1 x NOSIP-nitr...121,50 €
No products
To be determined Shipping
224,28 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 224,28 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 224,28 €
View larger 
Data sheet of LBH-limb bud and heart development homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about LBH-limb bud and heart development homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC012373 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | LBH |
| Origin species: | Human |
| Product name: | LBH-limb bud and heart development homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC012373 |
| Gene id: | 81606 |
| Gene description: | limb bud and heart development homolog (mouse) |
| Synonyms: | protein LBH; hLBH; limb bud and heart development homolog; limb bud and heart development |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccggggcaggaggacgagggtgcgctgtggacacagcagtccgcggaattccgttctgggaagccaatggtcgccggcaccccttgcttcctccctctgttgtctgcctgtgtgacacacatcaatggcaataacttcttccaactcctcgcagaagtgggagaggccggcagcctgcaccgagaggggctttcctctctcttgctccccgcttcgttctgttttggctgcagagagtggttcatccatactctcattccctcgcctccccttgtggacgggggtcttgccttttcaattcctgtgttttggtgtcttcccttatctgctaccctgaatcacctgtcctggtcttgctgtgtgatgggaacatgcttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily B, member 3 - La ribonucleoprotein domain family, member 2 - cyclin-dependent kinase 2-interacting protein - serine/threonine/tyrosine interacting protein |