Cart 1 Product Products 113,40 € (empty)
-
1 x C15orf48-c...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
Data sheet of CRB3-crumbs homolog 3 (Drosophila) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CRB3-crumbs homolog 3 (Drosophila) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC018409 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CRB3 |
| Origin species: | Human |
| Product name: | CRB3-crumbs homolog 3 (Drosophila) Gene |
| Size: | 2ug |
| Accessions: | BC018409 |
| Gene id: | 92359 |
| Gene description: | crumbs homolog 3 (Drosophila) |
| Synonyms: | protein crumbs homolog 3; crumbs family member 3; crumbs 3, cell polarity complex component |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgaaccccgggctggggctgcttctggcgctgggcctgccgttcctgctggcccgctggggccgagcctgggggcaaatacagaccacttctgcaaatgagaatagcactgttttgccttcatccaccagctccagctccgatggcaacctgcgtccggaagccatcactgctatcatcgtggtcttctccctcttggctgccttgctcctggctgtggggctggcactgttggtgcggaagcttcgggagaagcggcagacggagggcacctaccggcccagtagcgaggagcagttctcccatgcagccgaggcccgggcccctcaggactccaaggagacggtgcagggctgcctgcccatctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - Yip1 domain family, member 1 - H2A histone family, member V - hypothetical LOC26070 - Niemann-Pick disease, type C2 |