Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC015319 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLR1D |
| Origin species: | Human |
| Product name: | POLR1D-polymerase (RNA) I polypeptide D, 16kDa Gene |
| Size: | 2ug |
| Accessions: | BC015319 |
| Gene id: | 51082 |
| Gene description: | polymerase (RNA) I polypeptide D, 16kDa |
| Synonyms: | AC19; POLR1C; RPA16; RPA9; RPAC2; RPC16; RPO1-3; TCS2; DNA-directed RNA polymerases I and III subunit RPAC2; DNA-directed RNA polymerase I subunit D; RNA polymerases I and III subunit AC2; polymerase (RNA) I polypeptide D; polymerase (RNA) I polypeptide D, 16kDa; polymerase (RNA) I subunit D; RNA polymerase I subunit D |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaagaggatcaggagctggagaggaaagcaatagaagaactgcttaaggaggcaaaacgtgggaaaactagagctgaaacaatgggacccatgggttggatgaagtgtcctcttgctagcaccaataaaagatttctaattaacacaattaaaaacacattgccctctcataaagagcaagaccatgaacaaaaagagggcgataaggaaccagcgaagagccaggcccagaaagaagaaaacccgaagaaacacagaagccatccttacaagcacagcttccgcgctcgaggttccgccagttactccccgccacgaaagcggagcagccaggacaagtacgaaaagcggtccaaccggcggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - lectin, galactoside-binding, soluble, 1 - chromosome 14 open reading frame 129 - multiple coagulation factor deficiency 2 - chromosome 20 open reading frame 141 |