RGR-retinal G protein coupled receptor Gene View larger

RGR-retinal G protein coupled receptor Gene

PTXBC008094

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RGR-retinal G protein coupled receptor Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RGR-retinal G protein coupled receptor Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC008094
Product type: DNA & cDNA
Ncbi symbol: RGR
Origin species: Human
Product name: RGR-retinal G protein coupled receptor Gene
Size: 2ug
Accessions: BC008094
Gene id: 5995
Gene description: retinal G protein coupled receptor
Synonyms: RGR-opsin; RP44; RPE-retinal G protein-coupled receptor; retinal G protein coupled receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagagaccagtgccttgcccaccggcttcggggagctcgaggtgctggctgtggggatggtgctactggtggaagaccccggagctgcggactccctgccacctactggtgctgagcttggctcttgcggacagtgggatcagcctgaatgccctcgttgcagccacatccagccttctccgtgtctcccacaggcgctggccctacggctcggacggctgccaggctcacggcttccagggctttgtgacagcgttggccagcatctgcagcagtgcagccatcgcatgggggcgttatcaccactactgcacccgccaaaatgctgccatcggtctcatcattttgagtggcgatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ribonuclease P/MRP 14kDa subunit
- cAMP responsive element modulator
- cornichon homolog 4 (Drosophila)
- ribonuclease, RNase A family, 4

Reviews

Buy RGR-retinal G protein coupled receptor Gene now

Add to cart