Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene
PTXBC000899
New product
Data sheet of BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000899 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | BET1 |
| Origin species: | Human |
| Product name: | BET1-blocked early in transport 1 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC000899 |
| Gene id: | 10282 |
| Gene description: | blocked early in transport 1 homolog (S. cerevisiae) |
| Synonyms: | Bet1 golgi vesicular membrane trafficking protein; BET1 homolog; HBET1; Bet1p homolog; Golgi vesicular membrane trafficking protein p18; blocked early in transport 1 homolog; golgi vesicular membrane-trafficking protein p18 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaggcgtgcaggcctgggtgaaggagtacctcctggcaactatgggaactatggctatgctaatagtgggtatagtgcctgtgaagaagaaaatgagaggctcactgaaagtctgagaagcaaagtaactgctataaaatctctttccattgaaataggccatgaagttaaaacccagaataaattattagctgaaatggattcacaatttgattccacaactggatttctaggtaaaactatgggcaaactgaagattttatccagagggagccaaacaaagctgctgtgctatatgatgctgttttctttatttgtcttttttatcatttattggattattaaactgaggtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - vacuolar protein sorting 53 homolog (S. cerevisiae) - non-metastatic cells 1, protein (NM23A) expressed in - ARD1 homolog A, N-acetyltransferase (S. cerevisiae) - glucose-fructose oxidoreductase domain containing 2 |