Cart 1 Product Products 113,40 € (empty)
-
1 x FGFBP2-fib...113,40 €
No products
To be determined Shipping
113,40 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 1 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 113,40 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 113,40 €
View larger 
MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene
PTXBC001028
New product
Data sheet of MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001028 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | MRS2 |
| Origin species: | Human |
| Product name: | MRS2-MRS2 magnesium homeostasis factor homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC001028 |
| Gene id: | 57380 |
| Gene description: | MRS2 magnesium homeostasis factor homolog (S. cerevisiae) |
| Synonyms: | MRS2, magnesium transporter; MRS2-like, magnesium homeostasis factor; MRS2-like protein; magnesium transporter MRS2 homolog, mitochondrial; HPT; MRS2L |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggaatgcctgcgcagtttaccctgcctcctgccccgcgcgatgagacttccccggcggacgctgtgtgccctggccttggacgtgacctctgtgggtcctcccgttgctgcctgcggccgccgagccaacctgattggaaggagccgagcggcgcagctttgcgggcccgaccggctccgcgtggcaggtgaagtgcaccggtttagaacctctgacgtctctcaagccactttagccagtgtagccccagtatttactgtgacaaaatttgacaaacagggaaacgttacttcttttgtatttgaaagctgtgataactccagagtgtcttctgatattagattatcgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - tubulin polymerization-promoting protein family member 3 - ASF1 anti-silencing function 1 homolog B (S. cerevisiae) - ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b - N-6 adenine-specific DNA methyltransferase 2 (putative) |