Cart 11 Product Products 1 595,30 € (empty)
-
-
1 x ZBTB43-zin...121,50 € -
1 x BCAT2-bran...121,50 € -
1 x FLJ32063-h...113,40 € -
1 x LSM2-LSM2...113,40 € -
1 x THEX1-thre...121,50 € -
-
1 x C14orf94-c...121,50 € -
1 x SIAH1-seve...121,50 € -
1 x PHC2-polyh...121,50 € -
1 x NUF2-NUF2,...121,50 €
No products
To be determined Shipping
1 595,30 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 11 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 595,30 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 595,30 €
Data sheet of RPL34-ribosomal protein L34 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPL34-ribosomal protein L34 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC001773 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPL34 |
| Origin species: | Human |
| Product name: | RPL34-ribosomal protein L34 Gene |
| Size: | 2ug |
| Accessions: | BC001773 |
| Gene id: | 6164 |
| Gene description: | ribosomal protein L34 |
| Synonyms: | L34; 60S ribosomal protein L34; leukemia-associated protein; ribosomal protein L34 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtccagcgtttgacataccgacgtaggctttcctacaatacagcctctaacaaaactaggctgtcccgaacccctggtaatagaattgtttacctttataccaagaaggttgggaaagcaccaaaatctgcatgtggtgtgtgcccaggcagacttcgaggggttcgtgctgtaagacctaaagttcttatgagattgtccaaaacaaagaaacatgtcagcagggcctatggtggttccatgtgtgctaaatgtgttcgtgacaggatcaagcgtgctttccttatcgaggagcagaaaatcgttgtgaaagtgttgaaggcacaagcacagagtcagaaagctaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CD99 molecule-like 2 - ribosomal protein S19 - MYC associated factor X - PDZ and LIM domain 3 |