Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of GHRL-ghrelin/obestatin prepropeptide Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GHRL-ghrelin/obestatin prepropeptide Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025791 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GHRL |
| Origin species: | Human |
| Product name: | GHRL-ghrelin/obestatin prepropeptide Gene |
| Size: | 2ug |
| Accessions: | BC025791 |
| Gene id: | 51738 |
| Gene description: | ghrelin/obestatin prepropeptide |
| Synonyms: | MTLRP; appetite-regulating hormone; In2c-preproghrelin; ghrelin, growth hormone secretagogue receptor ligand; ghrelin/obestatin preprohormone; ghrelin/obestatin prepropeptide; growth hormone-releasing peptide; motilin-related peptide; prepro-appetite regulatory hormone; preproghrelin; ghrelin and obestatin prepropeptide |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgccctccccagggaccgtctgcagcctcctgctcctcggcatgctctggctggacttggccatggcaggctccagcttcctgagccctgaacaccagagagtccagcagagaaaggagtcgaagaagccaccagccaagctgcagccccgagctctagcaggctggctccgcccggaagatggaggtcaagcagaaggggcagaggatgaaatggaagtccggttcaacgccccctttgatgttggaatcaagctgtcaggggttcagtaccagcagcacagccaggccctggggaagtttcttcaggacatcctctgggaagaggccaaagaggccccagccgacaagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypothetical locus MGC42157 - FK506 binding protein 2, 13kDa - superoxide dismutase 1, soluble - gamma-glutamyl cyclotransferase |