Cart 6 Product Products 1 054,18 € (empty)
-
1 x C1orf49-ch...113,40 € -
-
1 x Ghrelin...474,00 € -
1 x C17orf66-c...113,40 € -
1 x C7orf11-ch...113,40 € -
1 x PELO-pelot...121,50 €
No products
To be determined Shipping
1 054,18 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 6 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 1 054,18 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 1 054,18 €
View larger 
VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene
PTXBC023286
New product
Data sheet of VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC023286 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VAMP1 |
| Origin species: | Human |
| Product name: | VAMP1-vesicle-associated membrane protein 1 (synaptobrevin 1) Gene |
| Size: | 2ug |
| Accessions: | BC023286 |
| Gene id: | 6843 |
| Gene description: | vesicle-associated membrane protein 1 (synaptobrevin 1) |
| Synonyms: | SPAX1; SYB1; VAMP-1; vesicle-associated membrane protein 1; vesicle-associated membrane protein 1 (synaptobrevin 1); vesicle associated membrane protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgctccagctcagccacctgctgaagggacagaagggactgccccaggtgggggtccccctggccctcctcctaacatgaccagtaacagacgactacagcaaacccaggcacaagtggaggaggtggtggacatcatacgtgtgaacgtggacaaggtcctggagagggaccagaagctgtcagagctggatgaccgagctgatgccttgcaggcaggagcatcacaatttgagagcagtgctgcaaagctaaagaggaagtattggtggaaaaactgcaagatgatgatcatgctgggagccatctgtgccatcatcgtggtagttattgtaagtaagtatcgctga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - microtubule-associated protein 1 light chain 3 alpha - ATP-binding cassette, sub-family C (CFTR/MRP), member 9 - tumor necrosis factor (ligand) superfamily, member 14 - MOB1, Mps One Binder kinase activator-like 1B (yeast) |